This time it's personal - A quick look at life beyond labbing (including pictures of DNA cake)

This has been sat on my computer since Friday and I've been meaning it post it, but got distracted by other things. It seems appropriate to post it now as I had quite a non-worky day, I had loads of end of term things to finish off, and managed to catch up with old friends both at lunch and at dinner.

Also, if anyone hasn't seen it, I wrote a post for the Lab Rat a few days ago. 

Last night was the lab Christmas dinner, so I thought I’d follow it up with a piece on the social side of my life. It is true that biological research can be quite demanding in terms of time. Sometimes you just have to be in the lab late night, early morning or at the weekends, to make sure the animals or cells you are working with stay healthy and to collect data. Thus it is very important to balance this with a healthy social life, something I have not always be great at.

The run up to Christmas in the lab, as in any setting, is usually a great time for socialising and having fun with colleagues, most labs will all go out for a Christmas dinner and most institutes and departments will host a Christmas party, usually involving fancy dress, and resulting in a lot of very memorable moments. It is important to maintain morale throughout the rest of the year though, the lab that I am currently a part of often get together for poker nights, whilst previous labs have organised bowling matches against neighbouring labs, have had film nights and even Nintendo Wii parties. These events are usually mainly attended by the more junior members of labs but are a brilliant way to bring the whole lab together beyond their common research interests and it really helps us to work better together. A common tradition in many of the labs I have worked in is to go out for a big lunch together towards the end of the month on payday.

As with many careers, research is also highly caffeine dependant, with regular and occasionally lengthy tea breaks in the morning and the afternoons. Sometimes your work requires that they must be skipped but equally if you time it right you can start of a nice hour long incubation just before leaving so that you’re in no rush to get back. Tea breaks also provide the perfect setting for all of the cake that I enjoy making. It is certainly very true that a lab, like an army, marches on its stomach and a regular supply of sweet treats is an excellent way to win friends and encourage people to let you come back and work with them again. I particularly remember tea breaks in my first lab placement, during the summer as an undergraduate; There we had a “tea train”, one of the researches would come through the lab pretending to be a train and encourage everyone to join on behind, so we could all go to the tea room together. That was also the lab that all wrote comments on an apron as my leaving gift, unfortunately it is so lovely and unique that I am reluctant to actually use it when I am cooking.

The joy of college based universities, like Cambridge, is that you have the social circle of your college as well as your department. Events for graduates are organised by the MCR (Middle Common Room) committee, an elected group of students, who are primarily responsible for organising freshers week. The current committee has been extremely proficient so far, and has organised several great parties here in college, as well as wine tasting and film nights. This weekend we have a tea and cake afternoon event, and next week there is an ice skating trip planned. I am also looking forward to the start of next term where they are apparently planning a re-freshers week, so that everyone can catch up after Christmas. It is really nice to come back to a relaxing social environment and free food, especially after a tough day at the lab.

There are also a lot of university events that are great to get involved in. As an undergraduate I took a lot of rock ‘n’ roll dance classes, a dance style that Cambridge is particularly strong in. Since it is quite an energetic dance style it manages to be tons of fun and good exercise at the same time. Classes like these are also a great way to meet people from outside the university and from very different backgrounds. Returning as a grad I fancied a change and decided to get into Salsa classes. Again I have had the opportunity to meet a great set of people from outside my course and have really enjoyed the exercise, though it is much less intensive that rock ‘n’ roll. I am also really pleased with how much easier it has been to pick up a new dance style having already done one. When I first started rock ‘n’ roll I was completely useless, and it took me quite a while to get even half decent. There is a salsa Christmas party going on tomorrow which I’m really excited about and am hoping to get lots of practice in, hopefully I can remember the few steps that I’ve learned this term.

(Ed. I went to the party, it was awesome although there woeren't many people there. They did a more advanced salsa class which was really challenging but loads of fun. Also rather intimidating to see how good some people are). 

Although I need to remember to relax, everything about salsa is much looser and softer than I am used to with the high tempo rock ‘n’ roll stuff. I’m looking forward to moving up to the intermediate level next term and learning some more complex stuff. I might give ballroom another go at some point too, I wasn’t very good the one time I tried it when I first arrived.

The other thing I’m doing this year is massage. I’ve always given friends shoulder massages and back rubs, the usual stuff, and I figured it was about time I actually learned how to do it properly. I’ve really enjoyed the first set of classes, which cover the basics, although I still find it very odd massaging with oils and having to think about it all, rather than just doing random stuff, but it does seem to be much more effective, surprisingly. The classes next term are designed to teach the different styles and techniques in massage which promises to be really exciting. I had an assessment last week to check that I’d learned it all properly, which thankfully I passed. I am also eternally grateful to my good friend the Lab Rat for volunteering to be my “client” for the assessment.

I spend a lot of time cooking. Besides cakes for events, labs and friends, I tend to do a lot of my own cooking, since I don’t entirely trust the “food” they serve in the colleges, and I enjoy deciding what to make. Not to mention that it’s a useful way to procrastinate the essay that needs writing or the presentation I should be working on. Also, I always enjoy the classic university challenge of trying to construct a meal out of the random food you have in the house.

As part of freshers week we had a safari night, I was one of the volunteers who cooked a 3 course meal for 4 or 5 guests, each guest was assigned a different house to go to for each course. Which meant for each course I had a new group of visitors, it was a brilliant evening and I really enjoyed the challenge of cooking a proper meal like that, it was also great to meet the other new freshers in a quieter context where it was much easier to have discussions and get to know people. I also catered my own, very successful, birthday party. This included making a Chrysler building cake for my friend who is an architect and whose birthday is the same week.

The Chrysler Cake

My own birthday cake, one of many offerings to the lab, was 5 turns of DNA double helix, with a hidden message in the codons (ATGCACGCCCCCCCCAAGAACATCAGGACCCACGACGCCAAGTGA, allow for coding errors in the 6th translated codon) also it's optimised for the human genome.

DNA cake at home

DNA cake in the lab

Most of my remaining time goes into watching TV and films, and the occasional 3 am card game with my housemates. I also enjoy singstar on my playstation, although I haven’t managed to organise a decent karaoke party this year, yet. Throw in some Final Fantasty, some Pokemon (yes I like it, I’m not ashamed) and a massive pile of Sci-fi books and I’m pretty happy.

Phew, and people say I don’t get out much…